Using image-based cytometry for characterizing CAR T cell expansion

Since the FDA first approved two Chimeric Antigen Receptor (CAR) T cell therapies against CD19+ malignancies, there has been considerable interest in modifying existing CAR technology for other diseases.

Thus, the capacity to monitor manufacturing criteria and functional characteristics of multiple CAR T cell products simultaneously using a single instrument would likely speed up the development of candidate therapies.

This article demonstrates how image-based cytometry generates high-throughput measurements of CAR T cell proliferation and size and captures the kinetics of in vitro antigen-specific CAR T cell-mediated killing.

The data acquired and analyzed by the image cytometer are compatible with results obtained using traditional technologies when tested simultaneously. Moreover, the use of brightfield and fluorescence microscopy by the image cytometer offers kinetic measurements and rapid data acquisition, which are clear advantages over industry-standard instruments.

Together, image cytometry facilitates fast, reproducible measurements of CAR T cell manufacturing criteria and effector function, which can significantly improve the evaluation of novel CARs with therapeutic potential.

Adoptive immunotherapy entails the transfer of immunocompetent cells for the treatment of pathologies with the objective to replace, restore or augment the biological function of the native immune response (Maldini et al., 2018).

Presently, the adoptive transfer of genetically modified, autologous Chimeric Antigen Receptor (CAR) T cells have provided a significant boost to the clinical outcome of patients with treatment-refractory B cell malignancies (Maude et al., 2014; Porter et al., 2015), leading to two FDA-licensed CAR T cell therapies.

CARs redirect T cell responses through the surface expression of an extracellular antigen-binding domain, generally, an antibody-derived single-chain variable fragment, merged with an intracellular domain made up of the TCR signal transduction domain (CD3-ζ) and one or more costimulatory domains (Gross et al., 1989; van der Stegen et al., 2015).

Given that CARs display a modular nature, each domain can be switched, allowing the production of engineered T cells with new functions and specificities.

Due to the recent success of CD19-targeted CAR T cell therapies, numerous researchers are evaluating novel CARs for other disease indications; however, preclinical assessment, including the simultaneous manufacturing and functional testing of multiple CAR T cell products, can be inefficient and labor-intensive (Levine et al., 2017).

As such, the capacity for a single instrument to measure these criteria will likely speed up the development and evaluation of novel immunotherapies.

The adoptive transfer of CAR T cells depends on the large scale ex vivo activation and expansion of genetically engineered T cells, producing > 1 × 109 CAR T cells for re-infusion into patients (Hay and Turtle, 2017).

This process necessitates activating purified, patient blood-derived T cells by ligating CD3 and CD28 surface receptors through monoclonal antibodies coupled to beads (Levine et al., 1998), or by co-culture with artificial antigen-presenting cells (Maus et al., 2002; Thomas et al., 2002).

The transduction of activated T cells can be performed with a viral vector containing the CAR and then grown logarithmically in culture for 1 to 2 weeks before the adoptive transfer into patients.

During the expansion phase, CAR T cells are routinely counted using automated cell counters, which have largely replaced manual hemocytometers, given their ability to precisely quantify cell number and size (Vembadi et al., 2019).

Throughout this time, the culture volume is consistently adjusted to lower the cell density and eliminate the build-up of waste products, such as lactate and ammonia (Somerville et al., 2012), which boosts cell growth and viability.

As well as measuring the growth rate, CAR T cells are vetted for phenotypic characteristics such as memory distribution and functionality, including antigen-specific cytokine release and target cell killing.

Together, these readouts depict key measures of quality control that need to be determined to guarantee consistent manufacturing of a uniform CAR T cell product (Levine et al., 2017).

Here, an efficient image-based cytometry method was developed using the Celigo Image Cytometer (Nexcelom Bioscience LLC.) to circumnavigate the limitations of traditional instruments that are used to measure CAR T cell expansion criteria and effector function during the manufacturing process (Chan et al., 2019; Magnotti et al., 2020).

This unique technique was validated against a frequently used cell counting method and a bioluminescence-based cytotoxicity assay by producing distinct HIV-specific CAR T cell populations from multiple donors. The in vitro growth kinetics and cytotoxic potential of these CAR T cells were then evaluated against antigen-presenting target cells.

Notably, image cytometry allowed the contemporaneous evaluation of distinct CAR T cell populations, which then enabled the growth rate and functionality of these cells to be compared.

Image cytometry offers a sensitive, kinetic and high-throughput method to evaluate the physiological functions of CAR T cells, which could enhance the efficiency for the determination of high-quality CAR T cell products with therapeutic potential.

Materials and methods

Ethics statement

Under an institutional review board (IRB)-approved protocol, de-identified, purified CD3+, CD8+ and CD4+ T cells from human donors were acquired by the University of Pennsylvania Human Immunology Core/CFAR Immunology Core.

Plasmid construction

The amino acid sequences for the HIV-specific CD4-based CAR constructs, including the following intracellular domains: CD3-ζ, 4- 1BB/CD3-ζ, CD28/CD3-ζ, CD28/4-1BB/CD3-ζ, CD27/CD3-ζ, OX40/ CD3-ζ and ICOS/CD3-ζ, have been described previously (Leibman et al., 2017).

For this study, amplification of each CAR from their original plasmid was carried out with the following primer: 5’-CACGTCCTAGGATGGCCTTACC AGTG and 5′- GTGGTCGACTTATGCGCTCCTGCTGAAC and cloned into pTRPE plasmid utilizing the AvrII and SalI restriction enzyme sites.

In this orientation, the CAR sequence is downstream of GFP or iRFP670 and a T2A sequence interferes to facilitate the expression of both proteins.

Lentivirus production and transfection

To produce the lentiviral particles containing each HIV-specific CAR, expression vectors coded with VSV glycoprotein, HIV Rev., HIV Gag, and Pol (pTRPE pVSV-g, pTRPE.Rev., and pTRPE g/p, respectively) were synthesized by DNA 2.0 or ATUM (Newark, CA).

They were then transfected into HEK293T cells with a pTRPE transfer vector encoding the CAR utilizing Lipofectamine 2000 (Life Technologies, Carlsbad, CA) in line with the manufacturer's protocol, and as previously detailed elsewhere (Richardson et al., 2008).

Transfected HEK293T cell supernatant was obtained 24 hours later, and then passed through a 0.45 μm nylon syringe filter and concentrated by ultracentrifugation for 2.5 hours at 25,000 RPM at 4 °C.

The supernatant was drawn out and the virus pellet was resuspended in 800 μL total volume of RPMI 1640, before storing four 200 μL aliquots at −80 °C for each CAR T cell construct.

Image-based cytometry reliably measures the kinetics and magnitude of in vitro CAR T cell expansion. A) Bright-field image and segmentation of individual T cells (blue) seeded in a 96-well microwell plate using the Celigo Image Cytometer. B) Triplicate serial dilutions of CD3+ T cells were counted by the image cytometer and Multisizer 3 and mean cell densities were plotted against theoretical values. Slope of each line is denoted as “m”. C) Cell density values measured by the image cytometer and Multisizer 3 from (B) were plotted against each other. Spearman correlation test was used to calculate significance. D) CD4+ T cells were activated with αCD3/CD28 Dynabeads and 24-h later were transduced with a lentivirus encoding an HIV-specific CAR containing the indicated intracellular domain (ICD). Population doublings were calculated by measuring the total cell number in culture at the indicated time-points using the image cytometer (square) and Multisizer 3 (circle). E) Comparison of paired CAR T cell population doublings on day 10 post-activation measured by the image cytometer and Multisizer 3. Wilcoxon matched pairs sign rank test was used to calculate significance (NS, P > 0.05). The comparison of CAR T cell expansion kinetics using the image cytometer and Multisizer 3 were repeated in two independent donors.

Figure 1. Image-based cytometry reliably measures the kinetics and magnitude of in vitro CAR T cell expansion. A) Bright-field image and segmentation of individual T cells (blue) seeded in a 96-well microwell plate using the Celigo Image Cytometer. B) Triplicate serial dilutions of CD3+ T cells were counted by the image cytometer and Multisizer 3 and mean cell densities were plotted against theoretical values. The slope of each line is denoted as “m”. C) Cell density values measured by the image cytometer and Multisizer 3 from (B) were plotted against each other. Spearman correlation test was used to calculate significance. D) CD4+ T cells were activated with αCD3/CD28 Dynabeads and 24-h later were transduced with a lentivirus encoding an HIV-specific CAR containing the indicated intracellular domain (ICD). Population doublings were calculated by measuring the total cell number in the culture at the indicated time-points using the image cytometer (square) and Multisizer 3 (circle). E) Comparison of paired CAR T cell population doublings on day 10 post-activation measured by the image cytometer and Multisizer 3. Wilcoxon matched-pairs sign rank test was used to calculate significance (NS, P > 0.05). The comparison of CAR T cell expansion kinetics using the image cytometer and Multisizer 3 were repeated in two independent donors. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.). Image Credit: Nexcelom Bioscience LLC

Image-based cytometry quantifies changes in CAR T cell size post-activation. A) Bright-field image of αCD3/CD28 Dynabeads seeded in 96-well microwell plate. B) Histogram of αCD3/CD28 Dynabeads imaged in (A) shows average bead area and diameter within min (10 μm2) and max (40 μm2) limits. C) Bright-field image of CAR T cells on days 0, 6 and 10 post-activation. D) Histogram of CAR T cell area at days 0 (red), 6 (black), 8 (blue) and 10 (green) post-activation by image cytometry and E) Multisizer 3. Data are representative of 2 donors. F) Longitudinal cell size calculated as cell surface area (μm2) of the indicated CAR T cell types measured by image cytometry and G) Multisizer 3. Data are representative of 2 donors. H) Correlation of cell size values from the image cytometer plotted against Multisizer 3. Each symbol represents a unique CAR T cell type 7 days post-activation. Spearman correlation test was used to calculate significance. The longitudinal comparison of CAR T cell size using the image cytometer and Multisizer 3 were repeated in two independent donors.

Figure 2. Image-based cytometry quantifies changes in CAR T cell size post-activation. A) Bright-field image of αCD3/CD28 Dynabeads seeded in 96-well microwell plate. B) Histogram of αCD3/CD28 Dynabeads imaged in (A) shows average bead area and diameter within min (10 μm2) and max (40 μm2) limits. C) Bright-field image of CAR T cells on days 0, 6, and 10 post-activation. D) Histogram of CAR T cell area at days 0 (red), 6 (black), 8 (blue) and 10 (green) post-activation by image cytometry and E) Multisizer 3. Data are representative of 2 donors. F) Longitudinal cell size calculated as cell surface area (μm2) of the indicated CAR T cell types measured by image cytometry and G) Multisizer 3. Data are representative of 2 donors. H) Correlation of cell size values from the image cytometer plotted against Multisizer 3. Each symbol represents a unique CAR T cell type 7 days post-activation. Spearman correlation test was used to calculate significance. The longitudinal comparison of CAR T cell size using the image cytometer and Multisizer 3 were repeated in two independent donors. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.). Image Credit: Nexcelom Bioscience LLC

Preparation of CAR T cells

Purified CD4+ and CD8+ T cells (RosetteSep, StemCell Technologies, Vancouver, Canada) were acquired by the University of Pennsylvania Human Immunology Core/CFAR Immunology Core from apheresis products of three de-identified healthy human donors (Donor 1, 2, 3).

CD4+ T cells were utilized in the experiments to tackle expansion kinetics (Fig. 1) and cell size (Fig. 2), while CD8+ T cells were employed in the cytotoxicity assays (Fig. 3 and Fig. 4).

To produce CAR T cells, all T cell subsets were cultivated at 1 × 106 cells mL−1 in a 24-well flat-bottom plate (Corning) in total RPMI 1640 with 10% FCS (Seradigm), 1% (v/v) Penicillin-Streptomycin (100 U mL−1 ), 2 mM GlutaMax and 25 mM HEPES buffer (Life Technologies).

T cell expansion medium was added to 100 U mL−1 recombinant human IL-2 (Clinigen). T cells were excited with αCD3/CD28 Dynabeads (Life Technologies) at a 3:1 bead-to-cell ratio at 37 °C, 5% CO2, and 95% humidity incubation conditions.

Around 18 hours after excitation, half of the medium was eliminated and replaced with 200 μL of concentrated lentiviral supernatant comprised of the appropriate HIV-specific CAR. Five days post-stimulation, the Dynabeads were taken out of the cell culture by magnetic separation.

T cells counts (cells mL−1 ) and size measurements (cell area, μm2 ) were measured on a day-to-day basis utilizing both the Celigo Image Cytometer (Nexcelom Bioscience LLC, Lawrence, MA) and Multisizer 3 Coulter Counter (Beckman Coulter, Brea, CA) as detailed below.

Once de-beading was completed, the cells were distributed in a 6-well flat bottom plate (Corning) and the cell concentration was modified to 0.5 × 106 cells mL−1 with complete RPMI supplemented with IL-2 (100 U mL−1 ) every second day (i.e., day 5, 7 and 9 post-stimulation).

In vitro HIV-specific CAR T cell-mediated killing assessed by image-based cytometry. HIV-specific CD8+ CAR T cells expressing the CD3ζ intracellular domain were mixed in triplicate with on-target K562 HIVYU2 GFP160+ cells (K.Env) or off-target K562 wild-type cells (K.WT) at 0.5, 0.25, 0.125, 0.061 and 0.0306:1 effector-to-target (E:T) ratios. Target cells stably expressed GFP linked to Click Beetle Green luciferase by an intervening T2A sequence. Cell lysis was determined by successive imaging of target cells using image cytometry and bioluminescence (BLI). A) Bright-field and fluorescence microscopy images of GFP+ K.Env cells and K.WT cells 72-h after co-culture acquired by the image cytometer. B) Specific lysis of on-target and off-target cells cultured with CAR T cells and measured by image cytometry and C) BLI. D) Specific lysis of on-target and off-target cells cultured with UTD T cells and measured with image cytometry and E) BLI. Specific lysis values were calculated as described for each method in Materials and Methods. Symbols represent mean and error bars show±SD. The comparison of CAR T cell-mediated cytotoxicity using image cytometry and BLI were repeated in 3 independent donors. All data are representative of 3 donors.

Figure 3. In vitro HIV-specific CAR T cell-mediated killing was assessed by image-based cytometry. HIV-specific CD8+ CAR T cells expressing the CD3ζ intracellular domain were mixed in triplicate with on-target K562 HIVYU2 GFP160+ cells (K.Env) or off-target K562 wild-type cells (K.WT) at 0.5, 0.25, 0.125, 0.061 and 0.0306:1 effector-to-target (E:T) ratios. Target cells stably expressed GFP linked to Click Beetle Green luciferase by an intervening T2A sequence. Cell lysis was determined by successive imaging of target cells using image cytometry and bioluminescence (BLI). A) Bright-field and fluorescence microscopy images of GFP+ K.Env cells and K.WT cells 72-h after co-culture acquired by the image cytometer. B) Specific lysis of on-target and off-target cells cultured with CAR T cells and measured by image cytometry and C) BLI. D) Specific lysis of on-target and off-target cells cultured with UTD T cells and measured with image cytometry and E) BLI. Specific lysis values were calculated as described for each method in Materials and Methods. Symbols represent mean and error bars show ± SD. The comparison of CAR T cell-mediated cytotoxicity using image cytometry and BLI were repeated in 3 independent donors. All data are representative of 3 donors. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.). Image Credit: Nexcelom Bioscience LLC

Image-based cytometry captures the kinetics of in vitro CAR T cell-mediated cytolysis. A) Fluorescence microscopy images of on-target GFP+ K.Env cells alone, or mixed with HIV-specific CD8+ CAR or UTD T cells at 0.5:1 E:T ratio at the indicated time points after co-culture acquired by the image cytometer. B) Enumeration of on-target cells and off-target GFP+ K.WT cells mixed with CD8+ CAR or UTD T cells at different E:T ratios at the indicated time points after co-culture. Symbols represent average of triplicate values and error bars show±SD. The comparison of CAR T cell-mediated cytotoxicity using image cytometry and BLI were repeated in 3 independent donors. All data are representative of 3 donors.

Figure 4. Image-based cytometry captures the kinetics of in vitro CAR T cell-mediated cytolysis. A) Fluorescence microscopy images of on-target GFP+ K.Env cells alone, or mixed with HIV-specific CD8+ CAR or UTD T cells at 0.5:1 E:T ratio at the indicated time points after co-culture acquired by the image cytometer. B) Enumeration of on-target cells and off-target GFP+ K.WT cells mixed with CD8+ CAR or UTD T cells at different E:T ratios at the indicated time points after co-culture. Symbols represent the average of triplicate values and error bars show ± SD. The comparison of CAR T cell-mediated cytotoxicity using image cytometry and BLI were repeated in 3 independent donors. All data are representative of 3 donors. Image Credit: Nexcelom Bioscience LLC

Preparation of K562 target cells

The K562 cell line was used to steadily transduce and express the HIVYU2 GP160 Envelope protein (K562.Env), a generous gift from Aimee Payne (University of Pennsylvania, Philadelphia, PA), and wild-type K562 cell line (K562.WT) (ATCC CCL-243) were held in complete RPMI 1640 at a density of 0.1 × 106 cells mL−1.

Both K562 cell lines were transduced with a lentiviral vector encoding GFP paired with Click Beetle Green (CBG) luciferase by an intermediate T2A sequence. The K562 cell lines were sorted on a single-cell basis using the Aria II (BD Bioscience) based on GFP expression.

For each cell line, the selection of an individual single-cell clone was based on uniform GFP expression and subsequently distributed for use in the cytotoxicity experiments.

T cell dilution series

Around 4 × 106 total T cells were moved into a single well of a 96-well flat-bottom plate (Corning #3596) in 200 μL of 1× PBS (Corning). Thereafter, 7 two-fold serial dilutions were made by transporting 100 μL of liquid-containing cells.

After the dilution series, 100 μL of 1× PBS was introduced to all wells for a final volume of 200 μL per well. The dilution series stretched across 107 to 0.156 × 107 cells mL−1 and was conducted in triplicate.

By mixing each well of the dilution series through a process of manual pipetting followed by the transfer of 10 μL of culture to a 96-well flat-bottom plate (Image Cytometer) and a coulter counter vial (Multisizer 3), cell concentration and average cell size were classified by the Image Cytometer and Multisizer 3.

The cell concentration values from each instrument were contrasted against theoretical values representing the 7 data points that make up the optimal cell concentrations of the dilution series in lieu of any error that may be caused by manual pipetting

T cell proliferation and size measurement using image cytometry

The Celigo Image Cytometer (Nexcelom Bioscience) uses one brightfield (BF) and four fluorescent (FL) imaging channels; blue (EX 377/50 nm, EM 470/22 nm), green (EX 483/32 nm, EM 536/ 40 nm), red (EX 531/40 nm, EM 629/53 nm) and far red (EX 628/ 40 nm, EM 688/31 nm) for high-throughput cell-based assays (David et al., 2017; Mazor et al., 2017; Fantini et al., 2018; Fantini et al., 2019; Rosen et al., 2019).

Target and effector cells seeded in standard multi-well microplates are automatically focused, imaged, and analyzed using Celigo software (version 5.1).

The software is made up of five main steps; START, SCAN, ANALYZE, GATE and RESULTS. Users can enter general information, set up imaging/analysis parameters, conduct imaging/analysis of cells, and view/export images and results.

Using Celigo’s Application “Target 1”, beads with a particular diameter in the brightfield channel were measured with an exposure time of ~2800 μs. Growth was measured using the Celigo Application “Target 1 + Mask” by counting total T cells in the brightfield channel in each well over a period of time.

Both Target 1 and Mask channels were set for brightfield illumination with exposure times 1 and ~ 3250 μs, respectively. The Mask channel facilitated the dilation of the outline diameter to enhance size measurement of T cells. Additionally, a specific image analysis template from FCS Express 6 (De Novo Software, Pasadena, CA) was utilized.

The counted T cell data (.ice files) were imported into the FCS Express (De Novo Software) after exportation from the image cytometer software. The subsequent template auto-generated size histograms, cell count, cell concentration, diameter (μm), minimum and maximum cell size (μm2 ), and average cell size (μm2 ).

The average cell size values were amplified by a factor of 4 to accommodate the surface area of spherical objects.

T cell proliferation and size measurement using the Multisizer 3

40 μL of cell culture was placed into individual Accuvette ST vials (Beckman Coulter) containing 20 mL of ISOTON II Diluent (Beckman Coulter).

Vials were then individually fixed onto the Multisizer 3 and cell concentration (cells mL−1 ) was predicated on volumetric sampling (500 μL) under the following conditions: 70 μm aperture, 1600 μA current, and a gain setting of 2. Cell size determination was carried out by applying a manual gate to all samples (range 150 μm2 to 1500 μm2 ).

The ‘Statistics’ function on the Beckman Coulter Particle Characterization software (v3.51), was used to determine the cell concentration and average cell size. Similarly, αCD3/CD28 Dynabeads beads at 4.5 μm diameter (Gibco) were analyzed and counted following the procedure as described above.

CAR T cell-mediated cytotoxicity assay

Untransduced (UTD) and CAR CD8+ T cells that expressed the CD3- ζ endodomain paired with iRFP670 were produced as described above. Before setting up the assay, CAR transduction efficiency was normalized across all donors based on positivity for iRFP670 expression detected by flow cytometry (BD LSR Fortessa).

For each donor, 2 × 104 CAR T cells were planted in complete RPMI, and then five 2-fold serial dilutions were conducted in a 96-well black polystyrene microplate (Corning #3603). 1 × 104 K562.Env.CBG.GFP or K562.WT.CBG.GFP cells were introduced to each well with final E:T ratios of 0.500, 0.250, 0.125, 0.061 and 0.031:1.

Target cells were cultivated in the absence of CAR T cells to take into account spontaneous death, while wells incorporating complete RPMI were only included as a measure for optimal killing (used for BLI-based assay).

Three technical replicates were conducted for each donor. Plates were cultivated at 37 °C, 5% CO2, and 95% humidity incubation conditions. The cytotoxicity measurements were evaluated at 0, 24, 48, and 72 hours using the image cytometer.

Cytotoxicity measurement using image cytometry

The Celigo application “Target 1” was employed for CAR T cell-mediated cytotoxicity assay, which only used the green fluorescence channel. Green fluorescent images were obtained with exposure times ranging from ~15,000 to 30,000 μs.

The image cytometer was utilized to count the number of GFP+ target cells directly in the wells with various donors and E:T ratios over time in triplicate for each condition. Since GFP fluorescence is reduced considerably as the target cells are killed throughout co-culture due to leakage, direct counting of the bright GFP+ cells represented feasible cells in the well.

Specific lysis was determined using the following: % Specific Lysis = 100 x (# cells in no effector wells - # cells in treatment well) / (# cells in no Effectors – 0 (max killing). Maximal killing indicates total target cell lysis; as such, this value is equal to 0. This calculation was carried out to categorize the normalized RLU data against the BLI-based assay.

Cytotoxicity measurement using BLI microplate reader

Directly after imaging the plate using the image cytometer at the 72-hour time point, D-Luciferin potassium salt was introduced to each well, creating a final concentration of 15 μg mL−1 (GoldBio) and incubated at 37 °C for 10 minutes.

Luminescence was quantified for 1 second with a luminometer (Synergy H4 Hybrid Microplate Reader) as relative light units (RLU). Triplicate wells were averaged and the percent specific lysis was determined using the following equation (Karimi et al., 2014) specific lysis (%) = 100 x [(spontaneous death RLU - treatment RLU)/ (spontaneous death RLU - maximal killing RLU)].

Maximal killing is indicative of the RLU measurement of wells containing complete RPMI in lieu of target and effector cells.

Statistical analysis

All statistical analysis was conducted using GraphPad Prism, version 7 (San Diego, CA). Comparison of means from matched samples was carried out using Wilcoxon matched-pairs signed-rank test. Bivariate correlations were executed using Spearman's rank correlation.

Results

Image-based cytometry measures CAR T cell expansion criteria during manufacturing

Image cytometry utilizes the brightfield channel and auto-focus feature to determine singular cells that are planted in a microwell plate (Fig. 1A), after which the well can be imaged and analyzed utilizing the Celigo software to determine cell density.

This cell counting method was validated by comparing the image cytometer to the Multisizer 3 (Beckman Coulter), an automated cell counter and particle sizing instrument commonly used in the hematology field that applies the coulter principle (Bessman et al., 1982; Fernyhough et al., 2003).

To achieve this, a triplicate series of two-fold T cell dilutions were prepared, from which cell counting measurements were made by each instrument. When compared against the theoretical values, the cell concentrations observed by the image cytometer and Multisizer 3 retained a high degree of linearity over the indicated range of dilutions (Fig. 1B) and demonstrated a strong correlation (r = 0.9996; Fig. 1C).

The image cytometer was then employed to observe the cell density of numerous CAR T cell products, applying a manufacturing process similar to the one used in clinical trials (Fesnak et al., 2016; Wang and Riviere, 2016).

Seven distinct CAR T cell products per donor were generated by transducing αCD3/CD28 bead-activated CD4+ T cells with single lentiviruses containing an HIV-specific CAR taken from the full-length CD4 extracellular region connected to an intracellular domain (ICD) made up of the TCR CD3-ζ (ζ) chain and one or more costimulatory domains; including 4-1BB, CD28, CD28/4-1BB, CD27, OX40 or ICOS (Supplementary Fig. 1).

Starting five days after the initial stimulation, the number of population doublings was calculated from baseline (day 0) utilizing the cell density values that the image cytometer and Multisizer 3 measured.

The expansion curves of each CAR T cell type produced by the image cytometer were almost identical to the Multisizer 3 (Fig. 1D), and no statistical differences were seen between the two methods comparing total population doublings after 10 days of initial culture (Fig. 1E).

Notably, we did not observe any substantial differences in proliferation among the CAR T cell populations with the exception of CAR T cells expressing the CD27/ζ ICD, which consistently exhibited fewer population doublings (Fig. 1D,E).

Following stimulation of the cognate antigen, T cell size increases due to the build-up of biomass prior to cellular division (Zangle et al., 2013). As such, simultaneous quantification of the size of expanding CAR T cells was conducted throughout manufacturing as a surrogate readout of their activation state.

However, to initially validate the image cytometry-based object sizing protocol, the diameter of αCD3/CD28 Dynabeads was measured.

The image cytometer identified the beads utilizing brightfield microscopy (Fig. 2A) and determined an average bead diameter of 5.2 μm (Fig. 2B), which closely resembles the manufacturer (Gibco) listed width of 4.5 μm.

This method was then applied to CAR T cells throughout the manufacturing process, and it was observed that the peak CAR T cell size (area, μm2 ) occurred 6 days after the initial stimulation before slowly contracting to a smaller, ‘rested’ size on day 10 (Fig. 2C-E).

The cell areas of each CAR T cell population were relatively similar during the expansion phase (Fig. 2F, G, and Supplementary Fig. 2), which was as anticipated given their equivalent proliferation kinetics (Fig. 1E).

Moreover, the cell areas determined by each method showed a significant correlation with one another (Fig. 2H). Together, the data captured by image cytometry were directly comparable to traditional technologies, supporting the use of this method to assess CAR T cell growth kinetics throughout the manufacturing process.

Image fluorescence microscopy captures the kinetics of in vitro CAR T cell-mediated killing

To correspond with traditional assays used to quantify the in vitro functional potency of CAR T cells, an investigation into whether the image cytometer could identify antigen-specific effector function was launched.

To do so, a cytotoxicity assay was set up utilizing untransduced (UTD) and HIV-specific CD8+ CAR T cells expressing the CD3-ζ ICD cultured at various effector-to-target (E:T) ratios with on-target K562 cells expressing the HIVYU2 GP160 protein (K.Env) or off-target, wild-type K562 cells (K.WT).

For this assay, these target cell lines were stably transduced using a lentiviral vector containing GFP linked to click beetle green luciferase by an intervening T2A sequence.

The addition of GFP facilitated the enumeration of GFP+ target cells by utilizing the image cytometer, followed by the sequential identification of bioluminescence (BLI) from luciferase activity using the same cluster of effector CAR T cells and K562 target cells.

As such, direct comparison of the extent of target cell killing measured by image cytometry to a standard BLI-based assay regularly used to determine cytotoxic potential (Karimi et al., 2014; Posey Jr. et al., 2016) was made possible.

The image cytometer detected GFP+ target cells accurately using the brightfield and green fluorescent channels, and significant CAR T cell-mediated reductions of on-target GFP+ K.Env cells (Fig. 3A), but no off-target GFP+ K.WT cells (Supplementary Fig. 3) were observed.

Specific lysis values were then calculated using the image cytometer and BLI-based assay at all E:T ratios 72-hours after co-culture. Both methods demonstrated that CAR T cells showed dose-dependent cytotoxicity at E:T ratios < 1; this effect was HIV-specific as only restricted off-target cytolysis took place (Fig. 3B and Supplementary Fig. 4A).

Conversely, UTD T cells induced minimal killing as less than 20% target cell lysis was observed across all E:T ratios (Fig. 3D, E, and Supplementary Fig. 4B).

While equivalent cultures were analyzed using both methods, the precise lysis values acquired by the BLI-based assay were slightly greater than the image cytometer (Supplementary Fig. 4C), indicating that there may be small differences in sensitivity.

However, the BLI-based assay also determined greater off-target CAR T cell-mediated killing - a potential result of background luciferase signals (Fig. 3C and Supplementary Fig. 4A).

It is crucial to note that both methods determined negative specific lysis, which suggests target cell growth in the control conditions, demonstrated by the accumulation of target cells in lieu of CAR T cells (Fig. 4A and Supplementary Fig. 5B).

Notably, image cytometry acquired the kinetics of CAR T cell mediated killing by counting GFP+ target cells without additional manipulation, in contrast to end-point BLI-based assays or the Chromium-51 release assay (Karimi et al., 2014).

The cells were imaged at 0, 24, 48, and 72 hours after co-culture, and marked CAR T cell-mediated reductions of on-target GFP+ K.Env cells beginning at 48-hours were observed (Fig. 4A). Cell lysis intensified 72-hours after co-culture, signaling that CAR T cells have sustained cytotoxic function capabilities (Fig. 4B and Supplementary Fig. 5A).

Crucially, limited off-target toxicity was observed as GFP+ K.WT cells demonstrated continuous unabated growth when cultured with CAR T cells at the E:T ratios as indicated (Fig. 4B, and Supplementary Fig. 5A, B).

In combination, this data demonstrates that image cytometry has the capacity to quantify in vitro antigen-specific CAR T cell-induced cytotoxicity and that the sensitivity of this method is comparable to traditional assays that evaluate effector CAR T cell function.

Discussion

The capacity to functionally determine a great number of CAR T cell products in a high-throughput and comparative manner can accelerate the discovery of novel CARs with therapeutic potential.

Current methods in place for measuring CAR T cell proliferation as well as cytotoxic potential throughout the manufacturing process can be labor-intensive, requiring the use of multiple pieces of equipment. The image-based cytometry method detailed in here was developed to eradicate such issues.

Throughout this, several advantages were noted when using image cytometry in contrast to traditional instruments. For example, the average time-to-scan, image and count T cells plated in a 96-well microplate by the image cytometer were 5 seconds per well compared to >30 seconds by the Multisizer 3 from Beckman Coulter.

Additionally, the brightfield and fluorescent images captured by the Celigo Image Cytometer resulted in the direct enumeration of numerous cell types without manipulating the culture system, which can boost the strength of readouts from assays that utilize indirect, end-point assays to quantify T cell proliferation (i.e., CFSE dilution) (Quah and Parish, 2012) or cytotoxicity (Nacasaki Silvestre et al., 2020).

Moreover, this platform is appropriate for future automation and adaption to additional assays to improve CAR T cell manufacturing as additional information becomes available in relation to which parameters of T cell manufacturing correspond to clinical benefit (Garfall et al., 2019).

Initially, the image cytometer used to calculate the cell density of multiple CAR T cell products during the manufacturing process was validated for comparison with the Multisizer 3.

The cell concentration values from both instruments were almost identical during an expansion (10 days), confirming that image-based cytometry accurately counted and identified CAR T cells.

Critically, the data enabled the expansion of CAR T cells at an optimal density by introducing new expansion medium to the culture, which also acts as a dilution for the waste products that build-up from cellular metabolism (Almeida et al., 2016).

Despite each CAR T cell type demonstrating a unique intracellular costimulatory domain, which is known to convey distinct functional properties (Weinkove et al., 2019), the CAR T cells displaced similar expansion kinetics over 10 days in culture.

This contrasts with data from the cancer field showing that some scFv-based CARs expressing clear costimulatory signals show differential expansion kinetics during ex vivo manufacturing (Kawalekar et al., 2016; Guedan et al., 2018), indicating that the HIV-specific CAR facilitates restricted ligand-independent signaling, a property that may boost resistance to exhaustion (Long et al., 2015).

Furthermore, the cell surface area of expanding CAR T cells was measured as a surrogate readout of cellular excitation (Zangle et al., 2013). Both instruments identified peak CAR T cell size 6 days post-activation (>350 μm2 ) before contracting on day 10 to a reduced size (<250 μm2 ).

However, it is crucial to note that each instrument utilizes a novel method to calculate cell size. For example, the Multisizer 3 calculates cell area by identifying the impedance of an electrical current measured as a voltage or current pulse.

This temporary change in impedance occurs as cells pass through the aperture, a volume of the electrolyte solution is supplanted from the sensing zone equivalent to the volume of the cell (Hurley, 1970).

Conversely, the image cytometer determines cell size by measuring the finite pixels of a cell captured in 2-dimensional space contained within the segmentation boundary and then accounts for the resolution of the acquired image.

This method generates a cross-sectional area, but for CAR T cells and other spherical objects, this measurement can be easily amended to take into account a 3-dimensional area.

Nevertheless, the cell sizes from both instruments were strongly associated with one another, signifying that image cytometry captured the pattern of cell size dynamics throughout CAR T cell manufacturing.

Effector cell-mediated cytotoxicity assays are frequently used to identify the in vitro function of CAR-modified and other pathogen-specific T cells (Nacasaki Silvestre et al., 2020). These assays typically measure target cell death by 3 mechanisms:

  1. The release of Chromium-51 (radioactivity) (Anurathapan et al., 2014), lactate dehydrogenase (enzymatic reaction) (Smith et al., 2011), or calcein (fluorescence) (Lichtenfels et al., 1994) from dead cells into the culture supernatant.
  2. The loss of viable target cells by flow cytometry (Karawajew et al., 1994; Hermans et al., 2004).
  3. Cell-associated luciferase activity (Karimi et al., 2014).

All three categories of assays tend to offer a fixed end-point measurement of cytotoxicity and consumption of samples.

End-point assays call for a need to replicate experiments to capture the kinetics of T cell killing, which may necessitate a large input of both effector and target cells. However, it was shown that an image cytometry-based approach produced a dependable assessment of cytotoxic CAR T cell function over time.

Notably, the image-cytometer can count and identify a wide range of target cell types through size exclusion or fluorescent labeling without using supplementary reagents, and as such, the kinetics of target cell lysis was measured by directly counting GFP+ target cells without disturbing or sacrificing cell samples.

Conversely, the BLI-based assay offered an indirect measurement of antigen-specific killing at a single time point (72-hours after co-culture). Moreover, the image cytometry-based method uses cell counts within the same well at 0-hours to normalize the particular lysis values at 24, 48, and 72-hours after co-culture.

In this way, the decline of GFP+ target cells references their individual wells rather than separate control wells, thus negating the potential variability intrinsically associated with pipetting or differences in target cell input between treatment and control wells.

As such, the capacity to evaluate and quantify cytotoxicity in a stringent, kinetic manner is a clear advantage of image cytometry.

In summary, with the developments in camera, optics, and image analysis technologies, image cytometry has established itself as a supplier of quantitative results to various aspects of biological assays (Chan et al., 2012; Kuksin et al., 2016; Chan et al., 2019; Magnotti et al., 2020).

For CAR T cell therapy, traditional methods that evaluate manufacturing criteria and effector function have led to the development of potent cellular products with the capacity to induce durable remissions for particular malignancies (Maude et al., 2014; Porter et al., 2015).

However, advanced technologies are necessary to accelerate the development and evaluation of preclinical candidate therapies.

Here, image cytometry offers a unique, efficient, and high-throughput characterization of CAR T cells throughout the manufacturing process, and a number of direct advantages over industry-standard equipment and routine assays have been demonstrated.

The findings outline the utility of image-based cytometry to evaluate multiple attributes of CAR T cells and demonstrate the potential of this method to speed up the discovery and validation of unique CAR T cell products.

References

Almeida, L., Lochner, M., Berod, L., Sparwasser, T., 2016. Metabolic pathways in T cell activation and lineage differentiation. Semin. Immunol. 28, 514–524.

Anurathapan, U., Chan, R.C., Hindi, H.F., Mucharla, R., Bajgain, P., Hayes, B.C., Fisher, W.E., Heslop, H.E., Rooney, C.M., Brenner, M.K., Leen, A.M., Vera, J.F., 2014. Kinetics of tumor destruction by chimeric antigen receptor-modified T cells. Mol. Ther. 22, 623–633.

Bessman, J.D., Williams, L.J., Gilmer Jr., P.R., 1982. Platelet size in health and hematologic disease. Am. J. Clin. Pathol. 78, 150–153.

Chan, L.L., Shen, D., Wilkinson, A.R., Patton, W., Lai, N., Chan, E., Kuksin, D., Lin, B., Qiu, J., 2012. A novel image-based cytometry method for autophagy detection in living cells. Autophagy 8, 1371–1382.

Chan, L.L., Wucherpfennig, K.W., de Andrade, L.F., 2019. Visualization and quantification of NK cell-mediated cytotoxicity over extended time periods by image cytometry. J. Immunol. Methods 469, 47–51.

David, J.M., Dominguez, C., McCampbell, K.K., Gulley, James L., Schlom, J., Palena, C., 2017. A novel bifunctional anti-PD-L1/TGF-β trap fusion protein (M7824) efficiently reverts mesenchymalization of human lung cancer cells. Oncoimmunology 6, e1349589.

Fantini, M., David, J.M., Saric, O., Dubeykovskiy, A., Cui, Y., Mavroukakis, S.A., Bristol, A., Annunziata, C.M., Tsang, K.Y., Arlen, A.P.M., 2018. Preclinical characterization of a novel monoclonal antibody NEO-201 for the treatment of human carcinomas. Front. Immunol. 8, 1899.

Fantini, M., David, J.M., Wong, H.C., Annunziata, C.M., Arlen, P.M., Tsang, K.Y., 2019. An IL-15 Superagonist, ALT-803, enhances antibody-dependent cell-mediated cytotoxicity elicited by the monoclonal antibody NEO-201 against human carcinoma cells. Cancer Biother. Radiopharm. 34, 147–159.

Fernyhough, M.E., Helterline, D.L., Vierck, J.L., Hill, R.A., Dodson, M.V., 2003. Coulter counter use in the enumeration of muscle and fat stem cells. Methods Cell Sci. 25, 221–225. Fesnak, A.D., June, C.H., Levine, B.L., 2016. Engineered T cells: the promise and challenges of cancer immunotherapy. Nat. Rev. Cancer 16, 566–581.

Garfall, A.L., Dancy, E.K., Cohen, A.D., Hwang, W.T., Fraietta, J.A., Davis, M.M., Levine, B.L., Siegel, D.L., Stadtmauer, E.A., Vogl, D.T., Waxman, A., Rapoport, A.P., Milone, M.C., June, C.H., Melenhorst, J.J., 2019. T-cell phenotypes associated with effective CAR T-cell therapy in postinduction vs relapsed multiple myeloma. Blood Adv 3, 2812–2815.

Gross, G., Waks, T., Eshhar, Z., 1989. Expression of immunoglobulin-T-cell receptor chimeric molecules as functional receptors with antibody-type specificity. Proc. Natl. Acad. Sci. U. S. A. 86, 10024–10028.

Guedan, S., Posey Jr., A.D., Shaw, C., Wing, A., Da, T., Patel, P.R., McGettigan, S.E., Casado-Medrano, V., Kawalekar, O.U., Uribe-Herranz, M., Song, D., Melenhorst, J.J., Lacey, S.F., Scholler, J., Keith, B., Young, R.M., June, C.H., 2018. Enhancing CAR T cell persistence through ICOS and 4-1BB costimulation. JCI Insight 3.

Hay, K.A., Turtle, C.J., 2017. Chimeric antigen receptor (CAR) T cells: lessons learned from targeting of CD19 in B-cell malignancies. Drugs 77, 237–245.

Hermans, I.F., Silk, J.D., Yang, J., Palmowski, M.J., Gileadi, U., McCarthy, C., Salio, M., Ronchese, F., Cerundolo, V., 2004. The VITAL assay: a versatile fluorometric technique for assessing CTL- and NKT-mediated cytotoxicity against multiple targets in vitro and in vivo. J. Immunol. Methods 285, 25–40.

Hurley, J., 1970. Sizing particles with a coulter counter. Biophys. J. 10, 74–79.

Karawajew, L., Jung, G., Wolf, H., Micheel, B., Ganzel, K., 1994. A flow cytometric longterm cytotoxicity assay. J. Immunol. Methods 177, 119–130.

Karimi, M.A., Lee, E., Bachmann, M.H., Salicioni, A.M., Behrens, E.M., Kambayashi, T., Baldwin, C.L., 2014. Measuring cytotoxicity by bioluminescence imaging outperforms the standard chromium-51 release assay. PLoS One 9, e89357.

Kawalekar, O.U., O’Connor, R.S., Fraietta, J.A., Guo, L., McGettigan, S.E., Posey Jr., A.D., Patel, P.R., Guedan, S., Scholler, J., Keith, B., Snyder, N.W., Blair, I.A., Milone, M.C., June, C.H., 2016. Distinct signaling of coreceptors regulates specific metabolism pathways and impacts memory development in CAR T cells. Immunity 44, 380–390.

Kuksin, D., Kuksin, C.A., Qiu, J., Chan, L.L., 2016. Cellometer image cytometry as a complementary tool to flow cytometry for verifying gated cell populations. Anal. Biochem. 503, 1–7.

Leibman, R.S., Richardson, M.W., Ellebrecht, C.T., Maldini, C.R., Glover, J.A., Secreto, A.J., Kulikovskaya, I., Lacey, S.F., Akkina, S.R., Yi, Y., Shaheen, F., Wang, J., Dufendach, K.A., Holmes, M.C., Collman, R.G., Payne, A.S., Riley, J.L., 2017. Supraphysiologic control over HIV-1 replication mediated by CD8 T cells expressing a re-engineered CD4-based chimeric antigen receptor. PLoS Pathog. 13, e1006613.

Levine, B.L., Cotte, J., Small, C.C., Carroll, R.G., Riley, J.L., Bernstein, W.B., Van Epps, D.E., Hardwick, R.A., June, C.H., 1998. Large-scale production of CD4+ T cells from HIV-1-infected donors after CD3/CD28 costimulation. J. Hematother. 7, 437–448.

Levine, B.L., Miskin, J., Wonnacott, K., Keir, C., 2017. Global manufacturing of CAR T cell therapy. Mol. Ther. Methods Clin. Dev. 4, 92–101. Lichtenfels, R., Biddison, W.E., Schulz, H., Vogt, A.B., Martin, R., 1994. CARE-LASS (calcein-release-assay), an improved fluorescence-based test system to measure cytotoxic T lymphocyte activity. J. Immunol. Methods 172, 227–239.

Long, A.H., Haso, W.M., Shern, J.F., Wanhainen, K.M., Murgai, M., Ingaramo, M., Smith, J.P., Walker, A.J., Kohler, M.E., Venkateshwara, V.R., Kaplan, R.N., Patterson, G.H., Fry, T.J., Orentas, R.J., Mackall, C.L., 2015. 4-1BB costimulation ameliorates T cell exhaustion induced by tonic signaling of chimeric antigen receptors. Nat. Med. 21, 581–590.

Magnotti, E.L., Chan, L.L.-Y., Zhu, Q., Marasco, W.A., 2020. A high-throughput chemotaxis detection method for CCR4+ T cell migration inhibition using image cytometry. J. Immunol. Methods 112747.

Maldini, C.R., Ellis, G.I., Riley, J.L., 2018. CAR T cells for infection, autoimmunity and allotransplantation. Nat. Rev. Immunol. 18, 605–616.

Maude, S.L., Frey, N., Shaw, P.A., Aplenc, R., Barrett, D.M., Bunin, N.J., Chew, A., Gonzalez, V.E., Zheng, Z., Lacey, S.F., Mahnke, Y.D., Melenhorst, J.J., Rheingold, S.R., Shen, A., Teachey, D.T., Levine, B.L., June, C.H., Porter, D.L., Grupp, S.A., 2014. Chimeric antigen receptor T cells for sustained remissions in leukemia. N. Engl. J. Med. 371, 1507–1517.

Maus, M.V., Thomas, A.K., Leonard, D.G., Allman, D., Addya, K., Schlienger, K., Riley, J.L., June, C.H., 2002. Ex vivo expansion of polyclonal and antigen-specific cytotoxic T lymphocytes by artificial APCs expressing ligands for the T-cell receptor, CD28 and 4-1BB. Nat. Biotechnol. 20, 143–148.

Mazor, Y., Sachsenmeier, K.F., Yang, C., Hansen, A., Filderman, J., Mulgrew, K., Wu, H., Dall’Acqua, W.F., 2017. Enhanced tumor-targeting selectivity by modulating bispecific antibody binding affinity and format valence. Sci. Rep. 7, 40098.

Nacasaki Silvestre, R., Moco, P.D., Picanco-Castro, V., 2020. Determination of cytotoxic potential of CAR-T cells in co-cultivation assays. Methods Mol. Biol. 2086, 213–222.

Porter, D.L., Hwang, W.T., Frey, N.V., Lacey, S.F., Shaw, P.A., Loren, A.W., Bagg, A., Marcucci, K.T., Shen, A., Gonzalez, V., Ambrose, D., Grupp, S.A., Chew, A., Zheng, Z., Milone, M.C., Levine, B.L., Melenhorst, J.J., June, C.H., 2015. Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia. Sci. Transl. Med. 7 303ra139.

Posey Jr., A.D., Schwab, R.D., Boesteanu, A.C., Steentoft, C., Mandel, U., Engels, B., Stone, J.D., Madsen, T.D., Schreiber, K., Haines, K.M., Cogdill, A.P., Chen, T.J., Song, D., Scholler, J., Kranz, D.M., Feldman, M.D., Young, R., Keith, B., Schreiber, H., Clausen, H., Johnson, L.A., June, C.H., 2016. Engineered CAR T cells targeting the cancerassociated Tn-Glycoform of the membrane mucin MUC1 control adenocarcinoma. Immunity 44, 1444–1454.

Quah, B.J., Parish, C.R., 2012. New and improved methods for measuring lymphocyte proliferation in vitro and in vivo using CFSE-like fluorescent dyes. J. Immunol. Methods 379, 1–14.

Richardson, M.W., Carroll, R.G., Stremlau, M., Korokhov, N., Humeau, L.M., Silvestri, G., Sodroski, J., Riley, J.L., 2008. Mode of transmission affects the sensitivity of human immunodeficiency virus type 1 to restriction by rhesus TRIM5alpha. J. Virol. 82, 11117–11128.

Rosen, O., Chan, L.L.-Y., Abiona, O.M., Gough, P., Wang, L., Shi, W., Zhang, Y., Wang, N., Kong, W.-P., McLellan, J.S., Graham, B.S., Corbett, K.S., 2019. A high-throughput inhibition assay to study MERS-CoV antibody interactions using image cytometry. J. Virol. Methods 265, 77–83.

Smith, S.M., Wunder, M.B., Norris, D.A., Shellman, Y.G., 2011. A simple protocol for using a LDH-based cytotoxicity assay to assess the effects of death and growth inhibition at the same time. PLoS One 6, e26908.

Somerville, R.P., Devillier, L., Parkhurst, M.R., Rosenberg, S.A., Dudley, M.E., 2012. Clinical scale rapid expansion of lymphocytes for adoptive cell transfer therapy in the WAVE(R) bioreactor. J. Transl. Med. 10, 69.

Thomas, A.K., Maus, M.V., Shalaby, W.S., June, C.H., Riley, J.L., 2002. A cell-based artificial antigen-presenting cell coated with anti-CD3 and CD28 antibodies enables rapid expansion and long-term growth of CD4 T lymphocytes. Clin. Immunol. 105, 259–272.

van der Stegen, S.J., Hamieh, M., Sadelain, M., 2015. The pharmacology of secondgeneration chimeric antigen receptors. Nat. Rev. Drug Discov. 14, 499–509.

Vembadi, A., Menachery, A., Qasaimeh, M.A., 2019. Cell cytometry: review and perspective on biotechnological advances. Front. Bioeng. Biotechnol. 7, 147.

Wang, X., Riviere, I., 2016. Clinical manufacturing of CAR T cells: foundation of a promising therapy. Mol. Ther. Oncolytics 3, 16015. Weinkove, R., George, P., Dasyam, N., McLellan, A.D., 2019. Selecting costimulatory domains for chimeric antigen receptors: functional and clinical considerations. Clin. Transl. Immunol. 8, e1049.

Zangle, T.A., Burnes, D., Mathis, C., Witte, O.N., Teitell, M.A., 2013. Quantifying biomass changes of single CD8+ T cells during antigen specific cytotoxicity. PLoS One 8, e68916. C

About Nexcelom Bioscience

Nexcelom Bioscience is a developer and marketer of image cytometry products for cell analysis in life science and biomedical research. Products range from cell viability counters (Cellometer) to high throughput microwell image cytometry workstations (Celigo), used in thousands of research laboratories in academic institutes, and pharmaceutical and biotech companies. The company contributes to the life science industry through innovation and expertise in the science of cell counting.

The product family includes instruments, consumables, and reagents. Nexcelom customers engage in a wide variety of research, such as cancer research, immunology, stem cell research, and neuroscience. Nexcelom offers different Cellometer models to count and analyze cell lines and primary cells, through brightfield and fluorescence imaging modes. In addition, Celigo is a powerful high image quality, high-throughput image cytometry system for adherent and suspension cells in microwell plates.

Nexcelom Bioscience is a fast-growing company in a huge market. With its headquarters and manufacturing facilities in the Boston area, the company currently has over 80 global employees, who are fast-paced, customer-centric, helpful to colleagues and customers, and passionate about their impact in life science.


Sponsored Content Policy: News-Medical.net publishes articles and related content that may be derived from sources where we have existing commercial relationships, provided such content adds value to the core editorial ethos of News-Medical.Net which is to educate and inform site visitors interested in medical research, science, medical devices, and treatments.

Last updated: Nov 2, 2021 at 6:59 AM

Citations

Please use one of the following formats to cite this article in your essay, paper or report:

  • APA

    Nexcelom Bioscience LLC. (2021, November 02). Using image-based cytometry for characterizing CAR T cell expansion. News-Medical. Retrieved on December 08, 2021 from https://www.news-medical.net/whitepaper/20211007/Using-image-based-cytometry-for-characterizing-CAR-T-cell-expansion.aspx.

  • MLA

    Nexcelom Bioscience LLC. "Using image-based cytometry for characterizing CAR T cell expansion". News-Medical. 08 December 2021. <https://www.news-medical.net/whitepaper/20211007/Using-image-based-cytometry-for-characterizing-CAR-T-cell-expansion.aspx>.

  • Chicago

    Nexcelom Bioscience LLC. "Using image-based cytometry for characterizing CAR T cell expansion". News-Medical. https://www.news-medical.net/whitepaper/20211007/Using-image-based-cytometry-for-characterizing-CAR-T-cell-expansion.aspx. (accessed December 08, 2021).

  • Harvard

    Nexcelom Bioscience LLC. 2021. Using image-based cytometry for characterizing CAR T cell expansion. News-Medical, viewed 08 December 2021, https://www.news-medical.net/whitepaper/20211007/Using-image-based-cytometry-for-characterizing-CAR-T-cell-expansion.aspx.

Other White Papers by this Supplier