Chromatrap 96 High Throughput ChIP for Screening Multiple Epigenetic Targets

Introduction

Advancements in the field of epigenetics are rapidly growing as researchers elucidate the principles controlling gene regulation via the in vivo binding of proteins to DNA. A major aspect in this is the need to study a vast  number of regulatory mechanisms to map interactions between DNA and protein following disease and pathogen stimulus.

Chromatin immunoprecipitation (ChIP) assays are widely utilized to examine these associations, but have been restricted to small sample numbers because of tedious washing steps, which result in sample loss, poor reproducibility, and low signal to noise.

This article describes the use of Chromatrap® 96 HT, a 96-well plate, for screening multiple epigenetic targets. Each well includes BioVyon, a solid phase rigid porous polymer to which Protein A or G is chemically bound, enabling 96 ChIP assays to be carried out in parallel on the same plate.

In order to demonstrate the ease of use as well as experimental design reproducibility and flexibility for screening various epigenetic targets with Chromatrap® 96, the binding efficiency and occupancy of common epigenetic marks - RNA pol II, H3, H4 and H3K4me3 - on three gene targets of interest (PABPC1, GAPDH and β-globin) in three different human chromatin samples (K562, HeLa and HepG2) were carried out simultaneously  on the 96-well plate and analysed using qPCR. Figure 1 shows the assay flow diagram.

Figure 1. Assay flow diagram. 96 ChIP Assays in 6 hours.

The methodology, statistical analysis, data interpretation as well as the advantages of using Chromatrap 96 high throughput ChIP are described below.

Methodology

Gene and Antibody Targets

Antibodies directed against common epigenetic markers, such as H3K4me3 (AM cat# 39915), Histone H4 (AM cat# 39269), and Histone H3 (AM cat# 39163) were selected as targets; all these antibodies were ChIP validated. Using Beacon primer design software, primers were optimized for PABPC1, β-globin and GAPDH genes. The table below outlines the amplicon specific data.

Table 1. Primer characteristics

Gene

5’-3’ Forward

5’-3’ Reverse

TM

Position

Amplicon

GAPDH

TCGACAGTCAGCCGCATCT

CTAGCCTCCCGGGTTTCTCT

60

5045-5094

69

PABPC1

GCGATGCTXTACGAGAAGTTC

GGCTGCTGGAAGTTCACATAC

59

5577-5669

113

β-Globin

CTGGTGGGGTGAATTCTTTGC

AGTCCAAGCTAGGCCCTTTT

58

5246893-5246995

121

Chromatin Preparation

Chromatin was prepared from three cell lines, K562 (ATCC Ref# CCL-243), HeLa (ATCC Ref# CCL-2), and HepG2 (ATCC Ref# HB-8065), as per the Chromatrap® protocol. Each cell line was cultured in fresh media as stipulated by ATCC. Using the Chromatrap® specific lysis buffer, cells were lysed and chromatin was obtained as standard. This chromatin was sonicated to create chromatin fragments in the region of 100-600 base pairs (Figure 2).

Figure 2. Qualitative analysis of chromatin.

Chromatin concentration was determined using a NanoDrop spectrophotometer and stocks were normalised to 1µg for input chromatin as standard. All samples were kept at -80°C before immunoprecipitation.

Immunoprecipitation and Detection

Each well of the 96-well plate was washed with double distilled water and centrifuged for 30 seconds at 2000xg. This was done to remove traces of the shipping solution. After this, each well was washed twice with Column Conditioning buffer and centrifuged at 2000xg for 1 minute on each occasion.

The slurries for each antibody precipitation contained a concentration of 1µl of PIC solution, 1µg of chromatin, 2µg of antibody, and 5µl of low salt buffer. The slurries were mixed thoroughly within each tube and applied into the 96-well plate at pre-determined positions. Then, the plate was incubated for 1 hour at 4°C and washed two times with low, medium and high salt buffers.

Chromatin was elutedwith kit supplied elution buffer, which was incubated for 15 minutes at room temperature on the column, and collected in a 96-well Elution plate. NaHCO3 and NaOH were added to each well and the plate was incubated in a thermal cycler for 2 hours at 65°C. Proteinase K solution was subsequently added and incubated for 1 hour at 37°C. The plate was then incubated for 5 minutes at 95°C in a thermal cycler to stop the reaction.

qPCR analysis was performed on the eluted sample, along the input (equivalent chromatin loading, not subjected to ChIP enrichment) to determine the amount of precipitation of each antibody from the plate set up, without the need for PCR clean up. Each precipitation assay was performed utilizing an equivalent loading of negative IgG antibody. The percventage precipitation (Ab-IgG) relative to the Input sample was analysed.

Results and Discussion

Improved signal relative to the input was identified for H3K4me3, RNA pol II, H3 and H4 antibody occupancy on each of the three targets genes detected (Figures 3-5).

Figure 3: Multiple target ChIP onto human gene promoters in liver carcinoma cells. (A) % real signal relative to Input (B) % precipitation of the input sample.

Figure 4: Multiple target ChIP onto human gene promoters in cervical carcinoma cells. (A) % real signal relativeto Input (B) % precipitation of the input sample.

Figure 5: Multiple target ChIP onto human gene promoters in  Leukaemia carcinoma cells. (A) % real signal relativeto Input (B) % precipitation of the input sample.

High percentage precipitation values for the antibodies selected shows the effectiveness of the Chromatrap® 96 assay for high throughput ChIP in three types of human chromatin samples. The percentage antibody relative to the Input was significantly higher when compared to the negative background IgG sample, indicating a good signal to noise ratio and an efficient assay, when the regulatory mark of choice was observed at each of the given gene loci.

Conclusion

It is clear that the Chromatrap® 96 well plate format has the ability to use different antibody target occupation of multiple gene targets in three different types of chromatin samples, on the same plate. The 96-well format enables broad experiment design possibilities, making it suitable for a wide range of histological samples. Efficient target precipitation was also seen on the target genes of interest, with excellent reproducibility across a large subset of individual assays.

Acknowledgment

Produced from articles provided by Chromatrap®.

About Chromatrap®

Chromatrap® is a product of Porvair Sciences, a wholly owned subsidiary of Porvair plc. We are one of the largest manufacturers of Ultra-Clean microplates, 96 well well filtration plates and Microplate handling equipment for life science and synthetic chemistry. With offices and Class VIII clean room manufacturing located in the UK, combined with a world-wide network of distributors and dedicated distribution hub in the USA, we pride ourselves on our continuous innovation, research and flexibility to meet customer demands. We offer OEM production and contract manufacturing through our North Wales facility.

Our porous polymeric material, BioVyon™, whose chemical functionalisation can endow it with internal surface properties  individually configured to capture and separate target species out of difficult mixtures, has opened up many possibilities in the field of BioSciences where molecules of interest such as DNA, RNA, proteins etc can be selectively pulled out of complex mixtures of biological origin. The materials have proven to be a remarkably good substrate for accepting novel chemistries such as the organically bound Protein A and Protein G in Chromatrap®.

Using our 25 years experience of microplate manufacturing, Porvair Sciences has now developed a high-throughput bead-free ChIP assay based on our filtration plates containing our Chromatrap chemistry. Chromatrap-96 enables large scale epigenetic screening to become a reality in many laboratories and eliminates many of the long and laborious steps previously undertaken in such work.


Sponsored Content Policy: News-Medical.net publishes articles and related content that may be derived from sources where we have existing commercial relationships, provided such content adds value to the core editorial ethos of News-Medical.Net which is to educate and inform site visitors interested in medical research, science, medical devices and treatments.

Last updated: Mar 23, 2020 at 10:28 AM

Citations

Please use one of the following formats to cite this article in your essay, paper or report:

  • APA

    Chromatrap® - Porvair Sciences Ltd. (2020, March 23). Chromatrap 96 High Throughput ChIP for Screening Multiple Epigenetic Targets. News-Medical. Retrieved on August 14, 2026 from https://www.news-medical.net/whitepaper/20140317/Chromatrap-96-High-Throughput-ChIP-for-Screening-Multiple-Epigenetic-Targets.aspx.

  • MLA

    Chromatrap® - Porvair Sciences Ltd. "Chromatrap 96 High Throughput ChIP for Screening Multiple Epigenetic Targets". News-Medical. 14 August 2026. <https://www.news-medical.net/whitepaper/20140317/Chromatrap-96-High-Throughput-ChIP-for-Screening-Multiple-Epigenetic-Targets.aspx>.

  • Chicago

    Chromatrap® - Porvair Sciences Ltd. "Chromatrap 96 High Throughput ChIP for Screening Multiple Epigenetic Targets". News-Medical. https://www.news-medical.net/whitepaper/20140317/Chromatrap-96-High-Throughput-ChIP-for-Screening-Multiple-Epigenetic-Targets.aspx. (accessed August 14, 2026).

  • Harvard

    Chromatrap® - Porvair Sciences Ltd. 2020. Chromatrap 96 High Throughput ChIP for Screening Multiple Epigenetic Targets. News-Medical, viewed 14 August 2026, https://www.news-medical.net/whitepaper/20140317/Chromatrap-96-High-Throughput-ChIP-for-Screening-Multiple-Epigenetic-Targets.aspx.

Other White Papers by this Supplier

While we only use edited and approved content for Azthena answers, it may on occasions provide incorrect responses. Please confirm any data provided with the related suppliers or authors. We do not provide medical advice, if you search for medical information you must always consult a medical professional before acting on any information provided.

Your questions, but not your email details will be shared with OpenAI and retained for 30 days in accordance with their privacy principles.

Please do not ask questions that use sensitive or confidential information.

Read the full Terms & Conditions.